sumzcts sumzcts
  • 01-10-2022
  • Mathematics
contestada

3. Answer the questions below.

(a) List 2 things that appreciate over time.

(b) List 2 things that depreciate over time.

(c) Paul bought a collector edition baseball card for $112 800. Every year the value of the card goes up by 5%. What would be the value of the card after 3 years has passed?

Respuesta :

Otras preguntas

Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Where did middle names come from
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Fossils are most commonly found in which type of rock?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Round 46.895 to the nearest tenth
How many years does an apple tree live useful?