sadie531 sadie531

02-11-2022
Mathematics

contestada

A garage that sells cars offers a 15% discount when paying cash.
Dave takes advantage of the deal and pays £6800 cash for a car.
Calculate the non-cash price of the car.

Respuesta :

Otras preguntas

Write the unit rate and the rate 225 chairs in 15 rows

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTA

How do you factor x^4-36?

Which of the Barbary states did Jefferson choose to blockade in 1801? A) Tripoli B) Morocco C) Algiers D) Tunis Please Help.

Explain how the process of diffusion works and what is needed to make it work

Nazism is actually a form of fascism. true or false

what will the presence of H+ ions in a solution cause?

In the state of Minnesota, Jude Flaw appears in court as plaintiff. The defendant charges that Mr. Flaw failed to complete plumbing work he promised to do. He

what was president George Washington leadership during the whiskeys rebellion was impacted because ?

Which word best completes this analogy? madrigal : song : : mumps : A. antidote B. disease C. predominance D. sentinel