tiara08 tiara08
  • 03-11-2022
  • Biology
contestada

Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9

Respuesta :

Otras preguntas

What is the lateral area of the rectangular prism? Assume the prism is resting on its base. A. 135 in2 B. 270 in2 C. 300 in2 D. 310 in2
Where do the cranial nerves originate? Where do the spinal nerves originate?
what time is 9 hours and 30 minutes before. 4:25
you have a full cylindrical glass of water that stands 8 inches tall and has a radius of 1.5 inches .if you pour the water into a larger cylindrical glass that
conversation between Hitler and gandhi
16 increased by twice a number is -24. Find the solution??
Al washed a car in 6 minutes. Fred washes the same car in 8 min. How long dies it take Al and Fred to wash the car together?
How many eighths are there in 4 1/4
The neolithic revolution is most closely associated with....
The dimensions of a brick that weighs 25 N are 0.19 m × 0.07 m × 0.095 m. What pressure does the brick exert on the ground if it is resting on its largest face?