sophiakoirala1 sophiakoirala1

02-01-2023
Mathematics

contestada

i need help please give explanation!!

i need help please give explanation class=

Respuesta :

Otras preguntas

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

if 2^x-4=4a^x-6 what is the value of a

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h

Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines

What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved