geekchic3141 geekchic3141
  • 02-01-2023
  • Mathematics
contestada

Frakies class designed a flag that’s is 228 square inches green fabric used and 24 inches of yellow fabric left over what is the area and how much of yellow and orange fabric was used

Respuesta :

Otras preguntas

4.2meters= how many centimeter
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
What were the driving forces behind the industrial revolution
Did feudalism create a stable form of government?