garciaM17171 garciaM17171

03-01-2024
Computers and Technology

contestada

Identify the value of i for which the skew array of "GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the position of the first occurrence only, with 1-based numeration with respect to the Genome (i.e., Skew[1] corresponds to "G" here)

Respuesta :

Otras preguntas

I need help asap please

What is the y-intercept of this line? y=-5x -3 b= [?]

sí por 5 días de trabajo un obrero gana $6588 Cuánto obtendrá por 18 días

( i only need number one and number 7 ) someone please i’m desperate i have so much work i need done by monday even if you only do one of them it is greatly app

J(2,-4), k(3,7), L(6,-1); x-axis

consumer act salient points

I need help with the statement and reason part. (Its ok if just one of the questions is answered.)

what happened before the Delano grape strike that caused it to occur? no googling answrs

The value of a farmhouse, in dollars, x years from the year it was built can by predicted by the function () = 65500(1.05)^x The value of a townhouse, in doll

Given the lengths of a triangle are x + 4, x -2 and x + 7, which value of x would verify the lengths that would make