Goldenhawk
Goldenhawk Goldenhawk
  • 05-10-2018
  • Mathematics
contestada

convert 7/11 into a decimal form. if your answer is a repeating decimal, round to two digits (hundreds).

Respuesta :

1Nattt1 1Nattt1
  • 05-10-2018

7/11 in decimal form = .6363

Answer Link

Otras preguntas

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is 0.00001267 is scientific notation
what rule does static electricity follow
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5