julietteb8 julietteb8

05-04-2019
Mathematics

contestada

graph a linear equation find three points that solve the equation -4y=x-18

Respuesta :

shorty0516 shorty0516

05-04-2019

y=-1/4x+9/2 this is what i got for your question

Answer Link

marianan422 marianan422

05-04-2019

Answer:

Slope: -1/4,Y-intercept:9/2

Step-by-step explanation:

divide each term by -4 and simplify.

y= -x/4+9/2

Answer Link

Otras preguntas

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..

Biggest reason why the united states did not want to enter world war 1

The most famous trade route, the silk road, connected _____________ with _________ and ___________.

paul has a standard deck of cards. what is the probability he will choose a 2?

The cube root of the square root of the real number in is 16. what is the value of n.

Attorney general a. mitchell palmer believed that he needed to protect the american people from

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Check the area that applies to a mesomorph body type. select one: a. trim waist b. trouble losing weight c. stoop-shouldered d. short heavy legs

Q&A Education