contestada

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′5′−GGCCCUUUUACCCGGUUUU−3′ 5′−GGCCCUUUUAGGGCCUUUUU−3′5′−GGCCCUUUUAGGGCCUUUUU−3′ a sequence of uracil–adenine RNA–DNA base pairs a palindromic region followed by a sequence of adenine residues in the RNA

Respuesta :

haneylia

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Otras preguntas

Q&A Education