thejoncarter52507 thejoncarter52507

05-03-2020
Mathematics

contestada

2. A ride in a taxicab costs $2.50 for the first mile and $1.50
for each additional mile or part of a mile.Write an equation
and make a graph that represents the total cost.

Respuesta :

kuangjason5 kuangjason5

05-03-2020

Answer:

The equation for this graph would be Y=1.50x+2.50.

Step-by-step explanation:

Because 1.50 is the price per mile and 2.50 is the starting price for the ride.

Answer Link

rajagrewal768 rajagrewal768

02-06-2022

The equation for this graph would be Y=1.50x+2.50.

What is the equation?

An equation is a formula that expresses the equality of two expressions, by connecting them with the equals sign =.

How to solve?

Because 1.50 is the price per mile and 2.50 is the starting price for the ride.

The equation for this graph would be Y=1.50x+2.50.

Learn more about Equations:

https://brainly.com/question/16450098

#SPJ2

Answer Link

Otras preguntas

Write the following roots as pure imaginary numbers: √ -81 5√ -180 someone help me please!!!!

In 1828 Conrad J.Van houten invented a pressbthat produced fine cocoa powder cocoa powder was easier to mix with water and led to new types of chocolate treats

the candy store sells gum balls for $3 per pound. which equation represents y, the total cost of gum balls for x pounds? pls show explanation

Iggies Ice Cream Company has taken a position in its tax return to claim a tax credit of $80 million (direct reduction in taxes payable) and has determined that

If the break-even exchange rate for the Currency Options Contract is 1.46 $/BP, and you believe the exchange rate at the time of the payment would be 1.43 $/BP,

Jerica takes her young son to the pediatrician for regular childhood immunizations. While there, they wait in a room full of sneezing, sniffling, coughing young

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Al examinar una mezcla de reactivos utilizando papel tornasol rojo, se obtiene una coloración azul indicativa de presencia de hidróxidos, el óxido que reaccionó

Write an equation of a line (in slope intercept or point slope form) with slope 3/5 that passes through the point (15,8)

PLS HELP!! i wrote these directions and i want to make sure they make sense for my spanish class please make any corrections if needed: Hola! Empieza a mi casa.