Type the complementary strand to the following single-stranded DNA.
5' – ATAGCATGGGCCATACGATTACTGA – 3'
Type your answer from 5' to 3', but INCLUDE ONLY the DNA sequence in your typed answer, NOT 5' or 3' characters.

Respuesta :

Answer: The complementary strand from 5' to 3' is TCAGTAATCGTATGGCCCATGCTAT

Explanation: DNA is a molecule having two antiparallel complementary strands. The two strands are antiparallel because as one runs in a 5->3' direction, the other strand runs from 3'->5' direction. In DNA base pairing, adenine pairs with thymine while cytosine pairs with guanine. The complementary strand of the above strand from 3'->5' is 3'TATCGTACCCGGTATGCTAATGACT5' but the question says the complementary strand should be written 5' to 3', therefore the complementary strand is TCAGTAATCGTATGGCCCATGCTAT