Buthead503 Buthead503
  • 03-05-2020
  • Mathematics
contestada

What is the arc measure of ABE in degrees?

What is the arc measure of ABE in degrees class=

Respuesta :

TREKKER
TREKKER TREKKER
  • 03-05-2020

Answer:

305 degrees

Step-by-step explanation:

360 -(93-38) =

360 - 93 + 38 =

305

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.
Ashya wants to focus on the diagnosis and treatment of psychological disorders and other problematic patterns of behavior. what area of psychology should she wo
x 2 • x 5 answer quick
The vessels that are responsible for carrying blood away from the heart are
Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?
What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu
who is the present president of liberia
How did the cold war shape american culture in the late 1950s and 1960s? what was the most important impact?