breonsalternateugd breonsalternateugd

04-09-2020
Engineering

contestada

A motor with an operating resistance of 32 Ω is connected to a voltage source. The current in the circuit is 3.8 A. What is the voltage in the circuit?

Respuesta :

sqdancefan sqdancefan

05-09-2020

Answer:

121.6 volts

Explanation:

V = IR

V = (3.8 A)(32 Ω) = 121.6 volts

Answer Link

Otras preguntas

Describe the proper positioning of the objectives, coarse focus and cord when you put away the microscope. objectives-

3.2.PS-33 Liam has 63 CDs, Alex has 49 CDs, and Michael has 77 CDs. Use the GCF and the Distributive Property to find the total number of CDs Liam, Alex, an

A chemist adds 50.0ML of a 0.20 mol/l sodium chloride solution to a reaction flask. Calculate the millimoles of sodium chloride the chemist has added to the fla

If the time is 0.2 seconds and the speed is 1500m/s what is the distance

When the pressure that a gas exerts on a sealed container changes from torr to 456 torr, the temperature changes from 150°C to 75.0°C.

Which is the reflection line for the transformation shown? x-axis y-axis x = -2 y = -2

two objects with the same mass move with the same speed but in opposite directions. A. Kinetic energies are equal B. Kinetic energies are opposite in magnitude

Balance the following unbalanced redox reaction (assume acidic solution if necessary): Cr2O72- + Cl- → Cl2 + Cr3+ Indicate the coefficient that will be used for

The three legged stool represents

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA