brookekash679 brookekash679

05-10-2020
Mathematics

contestada

HELP!!! is the answer for b correct? 10 points and marked brainliest

HELP is the answer for b correct 10 points and marked brainliest class=

Respuesta :

05-10-2020

Answer:

b

Step-by-step explanation:

Answer Link

aleeshasaji aleeshasaji

05-10-2020

Answer:

Your answer is correct.

Step-by-step explanation:

82.3 - 46.5 = 35.8

Answer Link

Otras preguntas

what is the answer and what does tan a mean

the world-systems approach argues that peripheral nations exploit core nations in various ways True or False

__________ is widely considered to be the founder of the professional american police department.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Name a few important body functions that your nervous system controls on its own without you having to think about it much?

PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t

14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.

Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the