ashleelaurel33 ashleelaurel33

05-10-2020
Mathematics

contestada

01.01)
Evaluate 32 + (8 − 2) ⋅ 4 − 6 over 3. (1 point)

Respuesta :

05-10-2020

Answer:

In the explanation. :)

Step-by-step explanation:

Find the exact value using trigonometric identities.

50 , 3 p o i n t

Hope this helps. Have a great day!

Answer Link

lakeshore61 lakeshore61

29-12-2020

Answer:

50 , 3

Step-by-step explanation:

Answer Link

Otras preguntas

Drag each image to the correct location on the chart. Declining genetic diversity is a result of both human activities and natural disasters. Classify the image

Raul ate 7/8 of 1/2 a pizza. How much of the pizza did Raul eat?

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

We want to find the zeros of this polynomial: p(x)= (x-1) (x+3) (2x+1)

3x + 2y = 16 ordered pair: (2 , 5) 1. The ordered pair IS a solution to the equation 2. The ordered pair IS NOT a solution to the equation

Consider the figure shown below. What is the volume of this figure? HELP PLEASEEE

prove that 1+tan²A= sec²A

How did the textile industry affect the people of New England in the 1800s?

Please give me correct valid answers

What happens in meiosis during telophase l?