izvolskyandrew izvolskyandrew
  • 03-12-2020
  • Mathematics
contestada

Triangle ABC and triangle PQR each have two sides whose lengths are 7 and an angle whose measure is 40. Are the triangles congruent? Why or Why not?

Respuesta :

yoyowolf422 yoyowolf422
  • 03-12-2020

No

Step-by-step explanation:

they could be but it doesnt say where the angle is so there isn't enough information to tell if they are congruent. answer is no

Answer Link

Otras preguntas

A generator stores electric current. Explain why you agree or disagree with this statement
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
why is the square root of a perfect square always rational
round 7,782 to the nearest hundred
How do I do trebuchet calculations????? Help me please
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the geometric mean between 6 and 20?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t