jaydaleecruz04 jaydaleecruz04

05-12-2020
Mathematics

contestada

Order the numbers from least to
greatest.

34, -1.7, 0.6, -74, 1.1

Respuesta :

alexd888 alexd888

05-12-2020

Answer:

-74,-1.7,0.6,1.1,34

Step-by-step explanation:

Answer Link

Otras preguntas

Which hormone is essential to our ability to maintain our fluid levels?

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h

Which component of a phospholipid is found in the interior of a lipid bilayer?

can someone help me please

A patient in a hospital has been diagnosed with malaria, which is a disease transmitted through mosquito bites. Jamie has an itchy, red bump where she was bit

Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.

A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The stroop effect demonstrates people's inability to ignore the ______ of words.

the members of an animal community are usually similar in