Sanchezdeavila017 Sanchezdeavila017

04-06-2021
Mathematics

contestada

En una venta de fin de temporada, unos tenis estan rebajados en 1/3 de su valor. Si originalmente costaban $850.00, ¿cuanto cuestan ahora? Redondea el resultado a dos decimales

Respuesta :

janannznznznznnzjzjz janannznznznznnzjzjz

04-06-2021

Hahsbabzbzbb 16616363

Answer Link

Otras preguntas

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?

Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.

Susan ........ (Run) to school because she was late.

Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se

what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place

Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20