jaadenvargas jaadenvargas
  • 04-11-2021
  • English
contestada

How is the last line of the story ironic?

From the “story of an hour”


Respuesta :

amy24357 amy24357
  • 04-11-2021
Since the story is about striving for freedom- exemplary through the open wi dow she sits in front of- the last line shows is ironic that even though she is dead, she still obtained that freedom that she had a taste of before reality came crashing back down on her.
Answer Link

Otras preguntas

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Give a recursive algorithm for finding the sum of the first n odd positive integers.
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
accurate estimation 719-348
How much money, in dollars, does one mole of nickels represent?
the bombing of Hiroshima and Nagasaki resulted in
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front