SnigdhaV660500 SnigdhaV660500

04-11-2022
Biology

contestada

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Respuesta :

RosaleighB446534 RosaleighB446534

04-11-2022

Cells decode mRNAs by reading their nucleotides in groups of three, called codons.

-One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine

UUCAAUGCCUCAAGGUUAAAGCGGCGG

So the first codon would be AUG

Answer Link

Otras preguntas

What does the ordered pair (2, 30) tell you about the number of windows repaired?

I have the question How many moles of CaO are produced as 0.248 moles of CaCO3 (s) is heated?

In what way does the hindenburg disaster demonstrate the effects that different media can have on a single event ?

is the savannah ecosystems endangerment due to natuarl causes

Probability Question 2

Salt, nacl, is formed by the ionic bonding of sodium and chlorine. the ions, one sodium and one chlorine, have a charge. what is the overall charge of the nacl

Intersecting lines forming linear pair which pair of angles is a linear pair?

What is the correct order, from smallest to largest, of michigan’s local government organization?

A construction crew has just finished building a road. The crew worked for 10.2 days. If they built 4.5 kilometers of road each day, find the total length

What is the approximate rate of plate movement??