elstar elstar
  • 01-11-2017
  • Mathematics
contestada

how many shelves will display 2 cars if 8 of the shelves each display 1 car

Respuesta :

ssjxavier
ssjxavier ssjxavier
  • 01-11-2017
16 would be the amount of shelves
Answer Link
Ripsy
Ripsy Ripsy
  • 01-11-2017
1 car needs 8 shelves. You need to know how many for 2 cars, so 8 x 2 = 16
Answer Link

Otras preguntas

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Step by step directions Square root for 480
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
find the prime factorization 504
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
A light bulb converts electrical energy into electromagnetic energy is true or false?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5